Industrializing Sequencing
Transforming Samples Into Integrated Knowledge
GUI
GUI
GUI
GUI
GUI
GUI
CLI
james@home:~$ hox get assemblies
ID       NAME                           STATUS    SIZE     CREATED_AT        UPDATED_AT
8f34c61c t2t-chm13v2-demo               completed 7.282GiB 28 hours ago      28 hours ago
17a004d6 t2t-chm13v2-maskedy-rcrs-decoy completed 7.282GiB 4 weeks ago       28 hours ago
james@home:~$ hox view assembly --regions 1:10-100 17a0
>1:10-100
CCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAAACCCTAACCCTAACCCTAACCCTAACCCTA
ACCCTAACCCT
james@home:~$ hox get family 17a0
REL   TYPE      NAME                          ID
child alignment CHM13-Element-ULTRAQ-BNUGQVID 15d33276
child alignment HG002-novaseq-35x-6ATYIYS5    94632aa4
child alignment HG002-Element-ULTRAQ-KE3TI7OA b1e5a730
james@home:~$ hox view alignment 15d33 --regions 1:10-100 > telomere_chunk.sam
james@home:~$ hox view alignment 15d33 --regions 1:10-100 | live_forever_app.py
Real-time data platform: Explore sequencing data at base pair granularity.
Ingest and immediately pre-process data.
Explore your entire inventory: All your sequencing data and metadata in one customizable view.
QC samples, view data provenance, and collaborate with notes and comments.
Seamlessly zoom to reveal larger, more complex details.
Compare samples side by side with synchronized navigation and search.
Script from anywhere: Your tools, your rules.
/
Integrated DATA

Working with sequencing data should be as simple as working with a modern database.

Transform scattered files into an integrated, queryable asset.

We envision a world where genomics data is as accessible as a database query - transforming billions of samples into a single computational resource.

/
THE Forge

Introducing HoX Forge – An operating system for industrial sequencing

A ground up system for generating, analyzing and deriving insights from billions of multi-modal samples.

A unified technology stack reducing sequencing complexity and costs by orders of magnitude.

/
ANSWERS PLATFORM

Expert services for research and industry

We partner with you to build and implement complete data solutions - from initial collection through analysis and ongoing management.

World Class Bioinformatics

We develop custom software that delivers enterprise-level performance at significantly reduced costs. Our solutions scale from individual labs to large organizations.

Sample Handling and Lab Automation

Choose between sending samples to our fully equipped lab or letting us modernize your existing facility with automated workflows. We handle everything from standard to complex, custom protocols.

Custom HPC Clusters

Get powerful on-premises computing at a fraction of cloud costs. Our Forge platform can reduce your AWS expenses by up to 90%. We offer flexible options including cluster leasing, full ownership, or hybrid solutions.

Flexible Sequencing Solutions:

Our cost-effective solutions support low-pass or deep DNA sequencing, plus bulk RNA, single-cell, and spatial transcriptomics.

Variant Caller Comparison
Explore HoX for your research
Test drive HoX using our CLI to see how your genomics research can be accelerated without the data frustration.
Schedule demo